union

 

Function

Reads sequence fragments and builds one sequence

Description

union reads in several sequences, concatenates them and writes them out as a single sequence.

It is most useful when the input sequences are specified in a List file. The List file (file of sequence names) can be any set of sequences in files or database entries specified in the normal EMBOSS USA (which can include the spcification of sub-regions of the sequence, eg. 'em:hsfau[20,55]'). Specifying several such subregions in a sequence or sequences allows you to enter disjoint sequences to be joined.

Usage

Here is a sample session with union

the file 'cds.list' contains a list of the regions making up the coding sequence of 'embl:hsfau':


% union 
Reads sequence fragments and builds one sequence
Input sequence(s): @cds.list
Output sequence [hsfau1.fasta]: 

Go to the input files for this example
Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     Sequence database USA
  [-outseq]            seqout     Output sequence USA

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1             integer    Start of each sequence to be used
   -send1               integer    End of each sequence to be used
   -sreverse1           boolean    Reverse (if DNA)
   -sask1               boolean    Ask for begin/end/reverse
   -snucleotide1        boolean    Sequence is nucleotide
   -sprotein1           boolean    Sequence is protein
   -slower1             boolean    Make lower case
   -supper1             boolean    Make upper case
   -sformat1            string     Input sequence format
   -sdbname1            string     Database name
   -sid1                string     Entryname
   -ufo1                string     UFO features
   -fformat1            string     Features format
   -fopenfile1          string     Features file name

   "-outseq" associated qualifiers
   -osformat2           string     Output seq format
   -osextension2        string     File name extension
   -osname2             string     Base file name
   -osdirectory2        string     Output directory
   -osdbname2           string     Database name to add
   -ossingle2           boolean    Separate file for each entry
   -oufo2               string     UFO features
   -offormat2           string     Features format
   -ofname2             string     Features file name
   -ofdirectory2        string     Output directory

   General qualifiers:
   -auto                boolean    Turn off prompts
   -stdout              boolean    Write standard output
   -filter              boolean    Read standard input, write standard output
   -options             boolean    Prompt for standard and additional values
   -debug               boolean    Write debug output to program.dbg
   -verbose             boolean    Report some/full command line options
   -help                boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning             boolean    Report warnings
   -error               boolean    Report errors
   -fatal               boolean    Report fatal errors
   -die                 boolean    Report deaths


Standard (Mandatory) qualifiers Allowed values Default
[-sequence]
(Parameter 1)
Sequence database USA Readable sequence(s) Required
[-outseq]
(Parameter 2)
Output sequence USA Writeable sequence <sequence>.format
Additional (Optional) qualifiers Allowed values Default
(none)
Advanced (Unprompted) qualifiers Allowed values Default
(none)

Input file format

The input can be any set of sequences in a file of multiple sequence entries or in a List file. The sequences are concatenated in the order in which they appear in the file.

Input files for usage example

File: cds.list

tembl-id:HSFAU1[782:856]
tembl-id:HSFAU1[951:1095]
tembl-id:HSFAU1[1557:1612]
tembl-id:HSFAU1[1787:1912]

You may find the program yank useful for creating List files.

Output file format

Output files for usage example

File: hsfau1.fasta

>HSFAU1 X65921.1 H.sapiens fau 1 gene
atgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacg
gtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtc
gtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggag
gccctgactaccctggaagtagcaggccgcatgcttggaggtaaagtccatggttccctg
gcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaag
aagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtg
cccacctttggcaagaagaagggccccaatgccaactcttaa

The result is a normal sequence file containing a single sequence resulting from the concatenation of the input sequences.

Data files

None.

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program nameDescription
biosedReplace or delete sequence sections
cutseqRemoves a specified section from a sequence
degapseqRemoves gap characters from sequences
descseqAlter the name or description of a sequence
entretReads and writes (returns) flatfile entries
extractfeatExtract features from a sequence
extractseqExtract regions from a sequence
listorWrites a list file of the logical OR of two sets of sequences
maskfeatMask off features of a sequence
maskseqMask off regions of a sequence
newseqType in a short new sequence
noreturnRemoves carriage return from ASCII files
notseqExcludes a set of sequences and writes out the remaining ones
nthseqWrites one sequence from a multiple set of sequences
pasteseqInsert one sequence into another
revseqReverse and complement a sequence
seqretReads and writes (returns) sequences
seqretsplitReads and writes (returns) sequences in individual files
skipseqReads and writes (returns) sequences, skipping the first few
splitterSplit a sequence into (overlapping) smaller sequences
trimestTrim poly-A tails off EST sequences
trimseqTrim ambiguous bits off the ends of sequences
vectorstripStrips out DNA between a pair of vector sequences
yankReads a sequence range, appends the full USA to a list file

You may find the program yank useful for creating List files.

Author(s)

Peter Rice (pmr © ebi.ac.uk)
Informatics Division, European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

History

Written (March 2002) - Peter Rice.

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None