Bio::Sequence objects represent annotated sequences in bioruby. A Bio::Sequence object is a wrapper around the actual sequence, represented as either a Bio::Sequence::NA or a Bio::Sequence::AA object. For most users, this encapsulation will be completely transparent. Bio::Sequence responds to all methods defined for Bio::Sequence::NA/AA objects using the same arguments and returning the same values (even though these methods are not documented specifically for Bio::Sequence).
# Create a nucleic or amino acid sequence dna = Bio::Sequence.auto('atgcatgcATGCATGCAAAA') rna = Bio::Sequence.auto('augcaugcaugcaugcaaaa') aa = Bio::Sequence.auto('ACDEFGHIKLMNPQRSTVWYU') # Print it out puts dna.to_s puts aa.to_s # Get a subsequence, bioinformatics style (first nucleotide is '1') puts dna.subseq(2,6) # Get a subsequence, informatics style (first nucleotide is '0') puts dna[2,6] # Print in FASTA format puts dna.output(:fasta) # Print all codons dna.window_search(3,3) do |codon| puts codon end # Splice or otherwise mangle your sequence puts dna.splicing("complement(join(1..5,16..20))") puts rna.splicing("complement(join(1..5,16..20))") # Convert a sequence containing ambiguity codes into a # regular expression you can use for subsequent searching puts aa.to_re # These should speak for themselves puts dna.complement puts dna.composition puts dna.molecular_weight puts dna.translate puts dna.gc_percent
classification | -> | taxonomy |
classification | [RW] | Organism classification, taxonomic classification of the source organism. (Array of String) |
comments | [RW] | Comments (String or an Array of String) |
data_class | [RW] | Data Class defined by EMBL (String) See www.ebi.ac.uk/embl/Documentation/User_manual/usrman.html#3_1 |
date_created | [RW] | Created date of the sequence entry (Date, DateTime, Time, or String) |
date_modified | [RW] | Last modified date of the sequence entry (Date, DateTime, Time, or String) |
dblinks | [RW] | Links to other database entries. (An Array of Bio::Sequence::DBLink objects) |
definition | [RW] | A String with a description of the sequence (String) |
division | [RW] | Taxonomic Division defined by EMBL/GenBank/DDBJ (String) See www.ebi.ac.uk/embl/Documentation/User_manual/usrman.html#3_2 |
entry_id | [RW] | The sequence identifier (String). For example, for a sequence of Genbank origin, this is the locus name. For a sequence of EMBL origin, this is the primary accession number. |
entry_version | [RW] | Version of the entry (String or Integer). Unlike sequence_version, entry_version is a database maintainer‘s internal version number. The version number will be changed when the database maintainer modifies the entry. The same enrty in EMBL, GenBank, and DDBJ may have different entry_version. |
error_probabilities | [RW] | Error probabilities of the bases/residues in the sequence. (Array containing Float, or nil) |
features | [RW] | Features (An Array of Bio::Feature objects) |
id_namespace | [RW] | Namespace of the sequence IDs described in entry_id, primary_accession, and secondary_accessions methods (String). For example, ‘EMBL’, ‘GenBank’, ‘DDBJ’, ‘RefSeq’. |
keywords | [RW] | Keywords (An Array of String) |
molecule_type | [RW] | molecular type (String). "DNA" or "RNA" for nucleotide sequence. |
moltype | [RW] | Bio::Sequence::NA/AA |
organelle | [RW] | (not well supported) Organelle information (String). |
other_seqids | [RW] | Sequence identifiers which are not described in entry_id, primary_accession,and secondary_accessions methods (Array of Bio::Sequence::DBLink objects). For example, NCBI GI number can be stored. Note that only identifiers of the entry itself should be stored. For database cross references, dblinks should be used. |
primary_accession | [RW] | Primary accession number (String) |
quality_score_type | [RW] |
The meaning (calculation method) of the quality scores stored in the
quality_scores attribute. Maybe one of :phred, :solexa, or nil.
Note that if it is nil, and error_probabilities is empty, some methods implicitly assumes that it is :phred (PHRED score). |
quality_scores | [RW] | Quality scores of the bases/residues in the sequence. (Array containing Integer, or nil) |
references | [RW] | References (An Array of Bio::Reference objects) |
release_created | [RW] | Release information when created (String) |
release_modified | [RW] | Release information when last-modified (String) |
secondary_accessions | [RW] | Secondary accession numbers (Array of String) |
seq | [RW] | The sequence object, usually Bio::Sequence::NA/AA, but could be a simple String |
sequence_version | [RW] | Version number of the sequence (String or Integer). Unlike entry_version, sequence_version will be changed when the submitter of the sequence updates the entry. Normally, the same entry taken from different databases (EMBL, GenBank, and DDBJ) may have the same sequence_version. |
species | [RW] | Organism species (String). For example, "Escherichia coli". |
strandedness | [RW] | Strandedness (String). "single" (single-stranded), "double" (double-stranded), "mixed" (mixed-stranded), or nil. |
topology | [RW] | Topology (String). "circular", "linear", or nil. |
Normally, users should not call this method directly. Use Bio::*to_biosequence (e.g. Bio::GenBank#to_biosequence).
Creates a new Bio::Sequence object from database data with an adapter module.
# File lib/bio/sequence.rb, line 463 463: def self.adapter(source_data, adapter_module) 464: biosequence = self.new(nil) 465: biosequence.instance_eval { 466: remove_instance_variable(:@seq) 467: @source_data = source_data 468: } 469: biosequence.extend(adapter_module) 470: biosequence 471: end
Given a sequence String, guess its type, Amino Acid or Nucleic Acid, and return a new Bio::Sequence object wrapping a sequence of the guessed type (either Bio::Sequence::AA or Bio::Sequence::NA)
s = Bio::Sequence.auto('atgc') puts s.seq.class #=> Bio::Sequence::NA
Arguments:
Returns: | Bio::Sequence object |
# File lib/bio/sequence.rb, line 283 283: def self.auto(str) 284: seq = self.new(str) 285: seq.auto 286: return seq 287: end
Guess the class of a given sequence. Returns the class (Bio::Sequence::AA or Bio::Sequence::NA) guessed. In general, used by developers only, but if you know what you are doing, feel free.
puts .guess('atgc') #=> Bio::Sequence::NA
There are three optional parameters: `threshold`, `length`, and `index`.
The `threshold` value (defaults to 0.9) is the frequency of nucleic acid bases [AGCTUagctu] required in the sequence for this method to produce a Bio::Sequence::NA "guess". In the default case, if less than 90% of the bases (after excluding [Nn]) are in the set [AGCTUagctu], then the guess is Bio::Sequence::AA.
puts Bio::Sequence.guess('atgcatgcqq') #=> Bio::Sequence::AA puts Bio::Sequence.guess('atgcatgcqq', 0.8) #=> Bio::Sequence::AA puts Bio::Sequence.guess('atgcatgcqq', 0.7) #=> Bio::Sequence::NA
The `length` value is how much of the total sequence to use in the guess (default 10000). If your sequence is very long, you may want to use a smaller amount to reduce the computational burden.
# limit the guess to the first 1000 positions puts Bio::Sequence.guess('A VERY LONG SEQUENCE', 0.9, 1000)
The `index` value is where to start the guess. Perhaps you know there are a lot of gaps at the start…
puts Bio::Sequence.guess('-----atgcc') #=> Bio::Sequence::AA puts Bio::Sequence.guess('-----atgcc',0.9,10000,5) #=> Bio::Sequence::NA
Arguments:
Returns: | Bio::Sequence::NA/AA |
# File lib/bio/sequence.rb, line 381 381: def self.guess(str, *args) 382: self.new(str).guess(*args) 383: end
Create a new Bio::Sequence object from a formatted string (GenBank, EMBL, fasta format, etc.)
s = Bio::Sequence.input(str)
Arguments:
Returns: | Bio::Sequence object |
# File lib/bio/sequence.rb, line 436 436: def self.input(str, format = nil) 437: if format then 438: klass = format 439: else 440: klass = Bio::FlatFile::AutoDetect.default.autodetect(str) 441: end 442: obj = klass.new(str) 443: obj.to_biosequence 444: end
Create a new Bio::Sequence object
s = Bio::Sequence.new('atgc') puts s #=> 'atgc'
Note that this method does not intialize the contained sequence as any kind of bioruby object, only as a simple string
puts s.seq.class #=> String
See Bio::Sequence#na, Bio::Sequence#aa, and Bio::Sequence#auto for methods to transform the basic String of a just created Bio::Sequence object to a proper bioruby object
Arguments:
Returns: | Bio::Sequence object |
# File lib/bio/sequence.rb, line 99 99: def initialize(str) 100: @seq = str 101: end
alias of Bio::Sequence.input
# File lib/bio/sequence.rb, line 447 447: def self.read(str, format = nil) 448: input(str, format) 449: end
Transform the sequence wrapped in the current Bio::Sequence object into a Bio::Sequence::NA object. This method will change the current object. This method does not validate your choice, so be careful!
s = Bio::Sequence.new('atgc') puts s.seq.class #=> String s.aa puts s.seq.class #=> Bio::Sequence::AA !!!
However, if you know your sequence type, this method may be constructively used after initialization,
s = Bio::Sequence.new('RRLE') s.aa
Returns: | Bio::Sequence::AA |
# File lib/bio/sequence.rb, line 422 422: def aa 423: @seq = AA.new(seq) 424: @moltype = AA 425: end
Guess the type of sequence, Amino Acid or Nucleic Acid, and create a new sequence object (Bio::Sequence::AA or Bio::Sequence::NA) on the basis of this guess. This method will change the current Bio::Sequence object.
s = Bio::Sequence.new('atgc') puts s.seq.class #=> String s.auto puts s.seq.class #=> Bio::Sequence::NA
Returns: | Bio::Sequence::NA/AA object |
# File lib/bio/sequence.rb, line 264 264: def auto 265: @moltype = guess 266: if @moltype == NA 267: @seq = NA.new(seq) 268: else 269: @seq = AA.new(seq) 270: end 271: end
Guess the class of the current sequence. Returns the class (Bio::Sequence::AA or Bio::Sequence::NA) guessed. In general, used by developers only, but if you know what you are doing, feel free.
s = Bio::Sequence.new('atgc') puts s.guess #=> Bio::Sequence::NA
There are three parameters: `threshold`, `length`, and `index`.
The `threshold` value (defaults to 0.9) is the frequency of nucleic acid bases [AGCTUagctu] required in the sequence for this method to produce a Bio::Sequence::NA "guess". In the default case, if less than 90% of the bases (after excluding [Nn]) are in the set [AGCTUagctu], then the guess is Bio::Sequence::AA.
s = Bio::Sequence.new('atgcatgcqq') puts s.guess #=> Bio::Sequence::AA puts s.guess(0.8) #=> Bio::Sequence::AA puts s.guess(0.7) #=> Bio::Sequence::NA
The `length` value is how much of the total sequence to use in the guess (default 10000). If your sequence is very long, you may want to use a smaller amount to reduce the computational burden.
s = Bio::Sequence.new(A VERY LONG SEQUENCE) puts s.guess(0.9, 1000) # limit the guess to the first 1000 positions
The `index` value is where to start the guess. Perhaps you know there are a lot of gaps at the start…
s = Bio::Sequence.new('-----atgcc') puts s.guess #=> Bio::Sequence::AA puts s.guess(0.9,10000,5) #=> Bio::Sequence::NA
Arguments:
Returns: | Bio::Sequence::NA/AA |
# File lib/bio/sequence.rb, line 328 328: def guess(threshold = 0.9, length = 10000, index = 0) 329: str = seq.to_s[index,length].to_s.extend Bio::Sequence::Common 330: cmp = str.composition 331: 332: bases = cmp['A'] + cmp['T'] + cmp['G'] + cmp['C'] + cmp['U'] + 333: cmp['a'] + cmp['t'] + cmp['g'] + cmp['c'] + cmp['u'] 334: 335: total = str.length - cmp['N'] - cmp['n'] 336: 337: if bases.to_f / total > threshold 338: return NA 339: else 340: return AA 341: end 342: end
Transform the sequence wrapped in the current Bio::Sequence object into a Bio::Sequence::NA object. This method will change the current object. This method does not validate your choice, so be careful!
s = Bio::Sequence.new('RRLE') puts s.seq.class #=> String s.na puts s.seq.class #=> Bio::Sequence::NA !!!
However, if you know your sequence type, this method may be constructively used after initialization,
s = Bio::Sequence.new('atgc') s.na
Returns: | Bio::Sequence::NA |
# File lib/bio/sequence.rb, line 401 401: def na 402: @seq = NA.new(seq) 403: @moltype = NA 404: end
Return sequence as String. The original sequence is unchanged.
seq = Bio::Sequence.new('atgc') puts s.to_s #=> 'atgc' puts s.to_s.class #=> String puts s #=> 'atgc' puts s.class #=> Bio::Sequence
Returns: | String object |
# File lib/bio/sequence/compat.rb, line 27 27: def to_s 28: String.new(self.seq) 29: end