![]() |
vrnafold |
The original program has additional inputs and produces different outputs, depending on the options selected. In the EMBASSY implementation it is split into vrnafold for a single sequence and vrnafoldpair for a pair of sequences
% vrnafold -constraintfile rna1.fold Calculate secondary structures of RNAs Input nucleotide sequence: rna1.seq Vienna RNAfold output file [rna1.vrnafold]: |
Go to the input files for this example
Go to the output files for this example
Example 2
% vrnafold Calculate secondary structures of RNAs Input nucleotide sequence: rna1.seq Vienna RNAfold output file [rna1.vrnafold]: |
Go to the output files for this example
Standard (Mandatory) qualifiers: [-sequence] sequence Nucleotide sequence filename and optional format, or reference (input USA) [-outfile] outfile [*.vrnafold] Vienna RNAfold output file Additional (Optional) qualifiers: (none) Advanced (Unprompted) qualifiers: -constraintfile infile Vienna RNA structure contraints file (optional) -paramfile infile Vienna RNA parameters file (optional) -temperature float [37.0] Temperature (Any numeric value) -circular boolean [N] Allow circular RNA -[no]gu boolean [Y] Allow GU pairs -[no]closegu boolean [Y] Allow GU pairs at end of helices -[no]lp boolean [Y] Allow lonely pairs -[no]convert boolean [Y] Convert T to U -nsbases string Non-standard bases (Any string is accepted) -[no]tetraloop boolean [Y] Stabilizing energies for tetra-loops -energy menu [0] Rarely used option to fold sequences from the ABCD... alphabet (Values: 0 (BP); 1 (Any with GC); 2 (Any with AU parameters)) -scale float [1.07] Estimate of ensemble free energy (Any numeric value) -dangles menu [1] Method (Values: 0 (Ignore); 1 (Only unpaired bases for just one dangling end); 2 (Always use dangling energies); 3 (Allow coaxial stacking of adjacent helices)) -ssoutfile outfile [*.vrnafold] Vienna structure postscript output file Associated qualifiers: "-sequence" associated qualifiers -sbegin1 integer Start of the sequence to be used -send1 integer End of the sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -sformat1 string Input sequence format -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-outfile" associated qualifiers -odirectory2 string Output directory "-ssoutfile" associated qualifiers -odirectory string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write standard output -filter boolean Read standard input, write standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages |
Standard (Mandatory) qualifiers | Allowed values | Default | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
[-sequence] (Parameter 1) |
Nucleotide sequence filename and optional format, or reference (input USA) | Readable sequence | Required | ||||||||
[-outfile] (Parameter 2) |
Vienna RNAfold output file | Output file | <*>.vrnafold | ||||||||
Additional (Optional) qualifiers | Allowed values | Default | |||||||||
(none) | |||||||||||
Advanced (Unprompted) qualifiers | Allowed values | Default | |||||||||
-constraintfile | Vienna RNA structure contraints file (optional) | Input file | Required | ||||||||
-paramfile | Vienna RNA parameters file (optional) | Input file | Required | ||||||||
-temperature | Temperature | Any numeric value | 37.0 | ||||||||
-circular | Allow circular RNA | Boolean value Yes/No | No | ||||||||
-[no]gu | Allow GU pairs | Boolean value Yes/No | Yes | ||||||||
-[no]closegu | Allow GU pairs at end of helices | Boolean value Yes/No | Yes | ||||||||
-[no]lp | Allow lonely pairs | Boolean value Yes/No | Yes | ||||||||
-[no]convert | Convert T to U | Boolean value Yes/No | Yes | ||||||||
-nsbases | Non-standard bases | Any string is accepted | An empty string is accepted | ||||||||
-[no]tetraloop | Stabilizing energies for tetra-loops | Boolean value Yes/No | Yes | ||||||||
-energy | Rarely used option to fold sequences from the ABCD... alphabet |
|
0 | ||||||||
-scale | Estimate of ensemble free energy | Any numeric value | 1.07 | ||||||||
-dangles | Method |
|
1 | ||||||||
-ssoutfile | Vienna structure postscript output file | Output file | <*>.vrnafold |
.((.......<<..........||............)).. |
>rna1 CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA |
%!PS-Adobe-3.0 EPSF-3.0 %%Creator: ePS_dot.c,v 1.1 2005/10/13 13:00:44 ajb Exp $, ViennaRNA-1.6 %%CreationDate: Sat Jul 15 12:00:00 2006 %%Title: Rna secondary Structure Plot %%BoundingBox: 66 210 518 662 %%DocumentFonts: Helvetica %%Pages: 1 %%EndComments %Options: -C % to switch off outline pairs of sequence comment or % delete the appropriate line near the end of the file %%BeginProlog /RNAplot 100 dict def RNAplot begin /fsize 14 def /outlinecolor {0.2 setgray} bind def /paircolor {0.2 setgray} bind def /seqcolor {0 setgray} bind def /cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def /min { 2 copy gt { exch } if pop } bind def /max { 2 copy lt { exch } if pop } bind def /drawoutline { outlinecolor newpath coor 0 get aload pop 0.8 0 360 arc coor {aload pop lineto} forall stroke } bind def /drawpairs { paircolor 0.7 setlinewidth [9 3.01] 9 setdash newpath pairs {aload pop coor exch 1 sub get aload pop moveto coor exch 1 sub get aload pop lineto } forall stroke } bind def % draw bases /drawbases { [] 0 setdash seqcolor 0 coor { aload pop moveto dup sequence exch 1 getinterval cshow 1 add [Part of this file has been deleted for brevity] [60.390 48.049] [52.724 35.155] [37.593 29.824] [32.464 14.623] [41.271 1.213] [57.259 -0.118] [68.162 11.650] [65.618 27.490] [73.283 40.384] [80.948 53.277] [88.614 66.171] [96.279 79.064] [109.219 80.839] [118.680 89.842] [121.094 102.678] [115.550 114.503] [122.206 127.946] [128.862 141.388] [135.517 154.831] [150.732 154.166] [164.899 159.754] [175.564 170.625] [180.879 184.896] [179.923 200.095] [172.862 213.588] [160.920 223.038] [146.165 226.807] [131.153 224.242] ] def /pairs [ [4 31] [5 30] [6 29] [7 28] [10 24] [11 23] [12 22] [13 21] [14 20] ] def init % switch off outline pairs or bases by removing these lines drawoutline drawpairs drawbases % show it showpage end %%EOF |
CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA ...((((..(((((.....)))))...))))......... ( -2.20) |
%!PS-Adobe-3.0 EPSF-3.0 %%Creator: ePS_dot.c,v 1.1 2005/10/13 13:00:44 ajb Exp $, ViennaRNA-1.6 %%CreationDate: Sat Jul 15 12:00:00 2006 %%Title: Rna secondary Structure Plot %%BoundingBox: 66 210 518 662 %%DocumentFonts: Helvetica %%Pages: 1 %%EndComments %Options: % to switch off outline pairs of sequence comment or % delete the appropriate line near the end of the file %%BeginProlog /RNAplot 100 dict def RNAplot begin /fsize 14 def /outlinecolor {0.2 setgray} bind def /paircolor {0.2 setgray} bind def /seqcolor {0 setgray} bind def /cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def /min { 2 copy gt { exch } if pop } bind def /max { 2 copy lt { exch } if pop } bind def /drawoutline { outlinecolor newpath coor 0 get aload pop 0.8 0 360 arc coor {aload pop lineto} forall stroke } bind def /drawpairs { paircolor 0.7 setlinewidth [9 3.01] 9 setdash newpath pairs {aload pop coor exch 1 sub get aload pop moveto coor exch 1 sub get aload pop lineto } forall stroke } bind def % draw bases /drawbases { [] 0 setdash seqcolor 0 coor { aload pop moveto dup sequence exch 1 getinterval cshow 1 add [Part of this file has been deleted for brevity] [76.515 91.594] [88.932 77.646] [107.552 76.227] [116.182 63.958] [124.812 51.689] [133.442 39.420] [142.071 27.151] [136.924 12.513] [141.395 -2.346] [153.767 -11.712] [169.282 -11.983] [181.974 -3.056] [186.962 11.637] [182.330 26.446] [169.857 35.678] [154.340 35.781] [145.711 48.050] [137.081 60.319] [128.451 72.587] [119.821 84.856] [124.925 99.035] [120.932 113.567] [109.299 123.146] [110.447 138.102] [111.596 153.058] [121.300 166.278] [114.456 181.181] ] def /pairs [ [2 38] [3 37] [4 36] [7 14] [8 13] [16 33] [17 32] [18 31] [19 30] [20 29] ] def init % switch off outline pairs or bases by removing these lines drawoutline drawpairs drawbases % show it showpage end %%EOF |
CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA .(((..((....)).(((((........)))))..))).. ( -3.50) |
Program name | Description |
---|---|
einverted | Finds DNA inverted repeats |
vrnaalifold | RNA alignment folding |
vrnaalifoldpf | RNA alignment folding with partition |
vrnacofold | RNA cofolding |
vrnacofoldconc | RNA cofolding with concentrations |
vrnacofoldpf | RNA cofolding with partitioning |
vrnadistance | RNA distances |
vrnaduplex | RNA duplex calculation |
vrnaeval | RNA eval |
vrnaevalpair | RNA eval with cofold |
vrnafoldpf | Secondary structures of RNAs with partition |
vrnaheat | RNA melting |
vrnainverse | RNA sequences matching a structure |
vrnalfold | Calculate locally stable secondary structures of RNAs |
vrnaplot | Plot vrnafold output |
vrnasubopt | Calculate RNA suboptimals |
Although we take every care to ensure that the results of the EMBOSS version are identical to those from the original package, we recommend that you check your inputs give the same results in both versions before publication.
Please report all bugs in the EMBOSS version to the EMBOSS bug team, not to the original author.