vrnasubopt

 

Function

Calculate RNA suboptimals

Description

This is a port of the Vienna RNA package program RNAsubopt.

Algorithm

See the original documentation for the Vienna RNA package http://www.tbi.univie.ac.at/~ivo/RNA/

Usage

Here is a sample session with vrnasubopt


% vrnasubopt 
Calculate RNA suboptimals
Input nucleotide sequence: rna1.seq
Vienna RNAfold output file [rna1.vrnasubopt]: 

Go to the input files for this example
Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   Nucleotide sequence filename and optional
                                  format, or reference (input USA)
  [-outfile]           outfile    [*.vrnasubopt] Vienna RNAfold output file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -constraintfile     infile     Vienna RNA structure contraints file
                                  (optional)
   -paramfile          infile     Vienna RNA parameters file (optional)
   -temperature        float      [37.0] Temperature (Any numeric value)
   -[no]gu             boolean    [Y] Allow GU pairs
   -[no]closegu        boolean    [Y] Allow GU pairs at end of helices
   -[no]lp             boolean    [Y] Allow lonely pairs
   -nsbases            string     Non-standard bases (Any string is accepted)
   -[no]tetraloop      boolean    [Y] Stabilizing energies for tetra-loops
   -erange             float      [1.0] Calculate suboptimal structures within
                                  erange of the mfe (Any numeric value)
   -prange             float      [0.0] Only print structures with energy
                                  within prange of the mfe (Any numeric value)
   -sort               boolean    [N] Sort structures by energy
   -logml              boolean    [N] Logarithmic energy function for
                                  multi-loops
   -dangles            menu       [2] Method (Values: 0 (Ignore); 1 (Only
                                  unpaired bases for just one dangling end); 2
                                  (Always use dangling energies); 3 (Allow
                                  coaxial stacking of adjacent helices))
   -nrandom            integer    [0] Number of random suboptimal structures
                                  (Any integer value)

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Standard (Mandatory) qualifiers Allowed values Default
[-sequence]
(Parameter 1)
Nucleotide sequence filename and optional format, or reference (input USA) Readable sequence Required
[-outfile]
(Parameter 2)
Vienna RNAfold output file Output file <*>.vrnasubopt
Additional (Optional) qualifiers Allowed values Default
(none)
Advanced (Unprompted) qualifiers Allowed values Default
-constraintfile Vienna RNA structure contraints file (optional) Input file Required
-paramfile Vienna RNA parameters file (optional) Input file Required
-temperature Temperature Any numeric value 37.0
-[no]gu Allow GU pairs Boolean value Yes/No Yes
-[no]closegu Allow GU pairs at end of helices Boolean value Yes/No Yes
-[no]lp Allow lonely pairs Boolean value Yes/No Yes
-nsbases Non-standard bases Any string is accepted An empty string is accepted
-[no]tetraloop Stabilizing energies for tetra-loops Boolean value Yes/No Yes
-erange Calculate suboptimal structures within erange of the mfe Any numeric value 1.0
-prange Only print structures with energy within prange of the mfe Any numeric value 0.0
-sort Sort structures by energy Boolean value Yes/No No
-logml Logarithmic energy function for multi-loops Boolean value Yes/No No
-dangles Method
0 (Ignore)
1 (Only unpaired bases for just one dangling end)
2 (Always use dangling energies)
3 (Allow coaxial stacking of adjacent helices)
2
-nrandom Number of random suboptimal structures Any integer value 0

Input file format

vrnasubopt reads any normal sequence USAs.

Input files for usage example

File: rna1.seq

>rna1
CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA

Output file format

vrnasubopt outputs a graph to the specified graphics device. outputs a report format file. The default format is ...

Output files for usage example

File: rna1.vrnasubopt

> rna1 [100]
CACTACTCCAAGGACCGTATCTTTCTCAGTGCGACAGTAA   -380    100
...(((((....)).((((.((.....))))))...))).  -2.80
...(((((....)).(((((........)))))...))).  -3.80
...(((((....)..(((((........)))))..)))).  -3.10
.(((..((....)).((((.((.....))))))..)))..  -2.80
.(((..((....)).(((((........)))))..)))..  -3.80
......((....)).(((((........))))).......  -3.10
...............(((((........))))).......  -3.30

Data files

See the original documentation for the Vienna RNA package http://www.tbi.univie.ac.at/~ivo/RNA/

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program nameDescription
einverted Finds DNA inverted repeats
vrnaalifold RNA alignment folding
vrnaalifoldpf RNA alignment folding with partition
vrnacofold RNA cofolding
vrnacofoldconc RNA cofolding with concentrations
vrnacofoldpf RNA cofolding with partitioning
vrnadistance RNA distances
vrnaduplex RNA duplex calculation
vrnaeval RNA eval
vrnaevalpair RNA eval with cofold
vrnafold Calculate secondary structures of RNAs
vrnafoldpf Secondary structures of RNAs with partition
vrnaheat RNA melting
vrnainverse RNA sequences matching a structure
vrnalfold Calculate locally stable secondary structures of RNAs
vrnaplot Plot vrnafold output

Author(s)

This program is an EMBOSS conversion of a program written by Ivo Hofacker as part of his VIENNA package.

Although we take every care to ensure that the results of the EMBOSS version are identical to those from the original package, we recommend that you check your inputs give the same results in both versions before publication.

Please report all bugs in the EMBOSS version to the EMBOSS bug team, not to the original author.

History

Converted (October 2005) by Alan Bleasby

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments