![]() |
vrnaalifold |
The original program produces different outputs, depending on the options selected. In the EMBASSY implementation it is split into vrnaalifold and vrnaalifoldpf
% vrnaalifold RNA alignment folding Input (aligned) nucleotide sequence set: ecoli6s.fasta Vienna RNAfold output file [ecoli6s.vrnaalifold]: |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers: [-sequence] seqset (Aligned) nucleotide sequence set filename and optional format, or reference (input USA) [-outfile] outfile [*.vrnaalifold] Vienna RNAfold output file Additional (Optional) qualifiers: (none) Advanced (Unprompted) qualifiers: -constraintfile infile Vienna RNA structure constraints file (optional) -paramfile infile Vienna RNA parameters file (optional) -temperature float [37.0] Temperature (Any numeric value) -[no]gu boolean [Y] Allow GU pairs -[no]closegu boolean [Y] Allow GU pairs at end of helices -[no]lp boolean [Y] Allow lonely pairs -[no]convert boolean [Y] Convert T to U -nsbases string Non-standard bases (Any string is accepted) -[no]tetraloop boolean [Y] Stabilizing energies for tetra-loops -energy menu [0] Rarely used option to fold sequences from the ABCD... alphabet (Values: 0 (BP); 1 (Any with GC); 2 (Any with AU parameters)) -scale float [1.07] Estimate of ensemble free energy (Any numeric value) -dangles menu [2] Method (Values: 0 (Ignore); 1 (Only unpaired bases for just one dangling end); 2 (Always use dangling energies); 3 (Allow coaxial stacking of adjacent helices)) -covariance float [1.0] Weight for covariance (Any numeric value) -nspenalty float [1.0] Non-compatible sequence penalty (Any numeric value) -endgaps boolean [N] Mark end gaps -most boolean [N] Use most informative sequence algorithm -ssoutfile outfile [*.vrnaalifold] Vienna structure postscript output file Associated qualifiers: "-sequence" associated qualifiers -sbegin1 integer Start of each sequence to be used -send1 integer End of each sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -sformat1 string Input sequence format -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-outfile" associated qualifiers -odirectory2 string Output directory "-ssoutfile" associated qualifiers -odirectory string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write standard output -filter boolean Read standard input, write standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages |
Standard (Mandatory) qualifiers | Allowed values | Default | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
[-sequence] (Parameter 1) |
(Aligned) nucleotide sequence set filename and optional format, or reference (input USA) | Readable set of sequences | Required | ||||||||
[-outfile] (Parameter 2) |
Vienna RNAfold output file | Output file | <*>.vrnaalifold | ||||||||
Additional (Optional) qualifiers | Allowed values | Default | |||||||||
(none) | |||||||||||
Advanced (Unprompted) qualifiers | Allowed values | Default | |||||||||
-constraintfile | Vienna RNA structure constraints file (optional) | Input file | Required | ||||||||
-paramfile | Vienna RNA parameters file (optional) | Input file | Required | ||||||||
-temperature | Temperature | Any numeric value | 37.0 | ||||||||
-[no]gu | Allow GU pairs | Boolean value Yes/No | Yes | ||||||||
-[no]closegu | Allow GU pairs at end of helices | Boolean value Yes/No | Yes | ||||||||
-[no]lp | Allow lonely pairs | Boolean value Yes/No | Yes | ||||||||
-[no]convert | Convert T to U | Boolean value Yes/No | Yes | ||||||||
-nsbases | Non-standard bases | Any string is accepted | An empty string is accepted | ||||||||
-[no]tetraloop | Stabilizing energies for tetra-loops | Boolean value Yes/No | Yes | ||||||||
-energy | Rarely used option to fold sequences from the ABCD... alphabet |
|
0 | ||||||||
-scale | Estimate of ensemble free energy | Any numeric value | 1.07 | ||||||||
-dangles | Method |
|
2 | ||||||||
-covariance | Weight for covariance | Any numeric value | 1.0 | ||||||||
-nspenalty | Non-compatible sequence penalty | Any numeric value | 1.0 | ||||||||
-endgaps | Mark end gaps | Boolean value Yes/No | No | ||||||||
-most | Use most informative sequence algorithm | Boolean value Yes/No | No | ||||||||
-ssoutfile | Vienna structure postscript output file | Output file | <*>.vrnaalifold |
>X01238.1/1-183 AUUUCUCUGAGAUGUUCGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUCCGU...............CCGAGA AGCCUUAAAACUGCGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG CGGCGGCA.UC.UCGGAG.AUUC >AL627277.1/108623-108805 AUUUCUCUGAGAUGUUUGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUUCGU...............CCGAGA AGCCUUAAAACUGUGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG CGGCGGCA.UC.UCGGAG.AUUC >AJ414145.1/90993-91174 AUUUCUCUGAGGUGUUUGCCAGCGGGC.CAGUCCCCUGAGCCGAUAUUUAAUACCAACAG AAUGUAGUGCUCCGUAACCGGUGAGCAUGCUCGGUCCG................CCGAGA AGCCUUAAGGUUGCGACGCUGCGUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG CGACGGCA.CC.UCGGAG.AUCC >U32767.1/6538-6734 .AUUACCUGGAGUGUUCGUCAGUAGGC.UAUGUCCCUGAGCCGAUACUUUAAAUCUUAUA AAUU.GGUUUCCUAUCGUUGGUGUGUAGGCUUAACCUUUGACUCGUUCAUUGGGCUAAGA AACCUGAAAACGGUAUCAACUGAUUU.CCUUGAACCGUCGGGUUCAAGGACUACUGCCCG CAGCGGCACUC.UGGGGU.CUUC >AE006208.1/8365-8185 .AUUACCUGAGGUGUUUGCCAGUGGGU.UAUGUCCCUGAGCCGAUACUUU.UAUUUUAUG AAUC.GGUUUCUAAUUGUUGGUGUGCAUGCUUAGCUUGA...............CUAAGA AGCCUAAAAAUAGUUAUAACUGAUUC.CCUUGAACCGUUGGGUUCAAGGACUGAGACUUG CAGCGGCA.UC.UCGGGUUCUUC >Y00334.1/77-254 CGCUCCCUGGUGUGUUGGCCAGUCGGU.GAUGUCCCUGAGCCGAUAACUGCAACAAC..G GAGGUUGC.CAGUUGGACCGGUGUGCAUGUCCGCACG.................ACGGAA AGCCUUAAGGUCUAC.UGCAACCGCCACCUUGAACUUUCGGGUUCAAGGGCUA.ACCCGA CAGCGGCA.CGACCGGGG.AGCU >AE004317.1/5626-5807 UUUACCCUGGGGUGUUCGUCAGCGGAUUUAUGUCCCUGAGCCGAUAAGCAACAUAAC..A GGGUUGGUAUUGGGUAGCUAUUGAGCAAGCUCGGCUUGUA..............CCGAGA AGCCUGCGGUUACCAUUACUGAUCCG.CCUUGAACCUGAUGGUUCAAGGGCUACGAUCCU CAACGGCA.UC.CCGGGG.UUC. |
AUUUCCCUGAGGUGUUCGCCAGCGGGC_CAUGUCCCUGAGCCGAUAUUUAAUACCACAAGAAUGUGGUGCUCCGUGGUUGGUGAGCAUGCUCGGCCCGU_______________CCGAGAAGCCUUAAAAUUGCGACGACACAUUCACCUUGAACCAA_GGGUUCAAGGGCUACAGCCUGCAGCGGCA_UC_UCGGGG_AUUC ....(((((((((((.(((..((((((................................(((((((......(((((((...(.((...(((((....................)))))..)))....)))))))....))))))).(((((((((....)))))))))......)))))).)))))).)).))))))..... (-56.91 = -48.71 + -8.20) |
%!PS-Adobe-3.0 EPSF-3.0 %%Creator: ePS_dot.c,v 1.1 2005/10/13 13:00:44 ajb Exp $, ViennaRNA-1.6 %%CreationDate: Sat Jul 15 12:00:00 2006 %%Title: Rna secondary Structure Plot %%BoundingBox: 66 210 518 662 %%DocumentFonts: Helvetica %%Pages: 1 %%EndComments %Options: -d2 % to switch off outline pairs of sequence comment or % delete the appropriate line near the end of the file %%BeginProlog /RNAplot 100 dict def RNAplot begin /fsize 14 def /outlinecolor {0.2 setgray} bind def /paircolor {0.2 setgray} bind def /seqcolor {0 setgray} bind def /cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def /min { 2 copy gt { exch } if pop } bind def /max { 2 copy lt { exch } if pop } bind def /drawoutline { outlinecolor newpath coor 0 get aload pop 0.8 0 360 arc coor {aload pop lineto} forall stroke } bind def /drawpairs { paircolor 0.7 setlinewidth [9 3.01] 9 setdash newpath pairs {aload pop coor exch 1 sub get aload pop moveto coor exch 1 sub get aload pop lineto } forall stroke } bind def % draw bases /drawbases { [] 0 setdash seqcolor 0 coor { aload pop moveto dup sequence exch 1 getinterval cshow 1 add [Part of this file has been deleted for brevity] 60 cmark 146 cmark 61 cmark 145 cmark 62 144 1 gmark 62 cmark 144 cmark 63 cmark 143 cmark 64 cmark 142 cmark 65 141 2 gmark 141 cmark 66 cmark 140 cmark 73 135 2 gmark 73 cmark 135 cmark 74 cmark 134 cmark 75 133 1 gmark 75 cmark 133 cmark 76 132 1 gmark 76 cmark 132 cmark 77 cmark 131 cmark 78 130 1 gmark 78 cmark 130 cmark 79 cmark 129 cmark 86 cmark 122 cmark 90 cmark 119 cmark 91 cmark 118 cmark 92 cmark 117 cmark 93 cmark 116 cmark 94 115 2 gmark 156 cmark % End Annotations % show it showpage end %%EOF |
Program name | Description |
---|---|
einverted | Finds DNA inverted repeats |
vrnaalifoldpf | RNA alignment folding with partition |
vrnacofold | RNA cofolding |
vrnacofoldconc | RNA cofolding with concentrations |
vrnacofoldpf | RNA cofolding with partitioning |
vrnadistance | RNA distances |
vrnaduplex | RNA duplex calculation |
vrnaeval | RNA eval |
vrnaevalpair | RNA eval with cofold |
vrnafold | Calculate secondary structures of RNAs |
vrnafoldpf | Secondary structures of RNAs with partition |
vrnaheat | RNA melting |
vrnainverse | RNA sequences matching a structure |
vrnalfold | Calculate locally stable secondary structures of RNAs |
vrnaplot | Plot vrnafold output |
vrnasubopt | Calculate RNA suboptimals |
Although we take every care to ensure that the results of the EMBOSS version are identical to those from the original package, we recommend that you check your inputs give the same results in both versions before publication.
Please report all bugs in the EMBOSS version to the EMBOSS bug team, not to the original author.