EMBOSS: degapseq


Program degapseq

Function

Removes gap characters from sequences

Description

degapseq reads in one or more sequences and writes them out again minus any gap characters. In effect it removes gaps from aligned sequences.

In fact, if does more than just this as it removes ANY non-alphabetic character from the input sequence, so as well as removing the gap-characters, it will remove such things as the '*' in protein sequenecs that indicates the position of a 'translated' STOP codon.

There are many different formats for storing sequences in files. Some sequence formats allow you to store aligned sequences, including the information on where gaps have been introduced to make the sequence align properly. This is indicated by using a special character to indicate that there is a gap at that position. Different sequence formats use different characters to indicate gaps. Some formats may use more than one type of character to indicate different types of gaps (e.g. gaps at the ends of the sequences, internal gaps, gaps introduced by a program or by a person editing the alignment, etc.) Some typicate characters used to indicate where gaps are may be: '.', '-' and '~'.

When EMBOSS programs read in a sequence that has gap-characters in, all gap characters are internally changed to '-' characters. i.e. EMBOSS only has one type of gap character. Thus any distinguishing characters for different gap types are reduced to a '-'. There is only one type of gap in EMBOSS.

degapseq removes any non-alphabetic character in the sequence, in effect this means that gaps and '*' characters are removed. The sequence is then written out.

Usage

Here is a sample session with degapseq:

% degapseq alignment.seq nogaps.seq

Command line arguments

   Mandatory qualifiers:
  [-sequence]          seqall     Sequence database USA
  [-outseq]            seqoutall  Output sequence(s) USA

   Optional qualifiers: (none)
   Advanced qualifiers: (none)
   General qualifiers:
  -help                bool       report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose


Mandatory qualifiers Allowed values Default
[-sequence]
(Parameter 1)
Sequence database USA Readable sequence(s) Required
[-outseq]
(Parameter 2)
Output sequence(s) USA Writeable sequence(s) <sequence>.format
Optional qualifiers Allowed values Default
(none)
Advanced qualifiers Allowed values Default
(none)

Input file format

Any valid input sequence USA is allowed.

The input sequence can be nucleic or protein.

The input sequence can be gapped or ungapped.

An example of a sequence with gaps might be:

>dgshsh
ATGCGCAGGTACGTATG....CTGACGGTACGTGATCGA-GCTGA-CGAGCGTATGC-----
>hsf1
--------TGACTGATGCTGA~~~~CTG-ACGTGACTGATGCTGATCGTGACTGATCGTGAC
>myclone1
ATGCGCAGGTACGTATGCTGACGGTACGTGATCGA-GCTGA-CGAGCGTATGC-----

Output file format

The output is a sequence with no gaps.

An example is the ouput of the above input sequence:

>dgshsh
ATGCGCAGGTACGTATGCTGACGGTACGTGATCGAGCTGACGAGCGTATGC
>hsf1
TGACTGATGCTGACTGACGTGACTGATGCTGATCGTGACTGATCGTGAC
>myclone1
ATGCGCAGGTACGTATGCTGACGGTACGTGATCGAGCTGACGAGCGTATGC

Data files

None.

Notes

None.

References

None.

Warnings

It will remove '*' characters from protein sequences as well as removing the gap characters.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program nameDescription
biosedReplace or delete sequence sections
cutseqRemoves a specified section from a sequence
descseqAlter the name or description of a sequence
entretReads and writes (returns) flatfile entries
extractfeatExtract features from a sequence
extractseqExtract regions from a sequence
listorWrites a list file of the logical OR of two sets of sequences
maskfeatMask off features of a sequence
maskseqMask off regions of a sequence
newseqType in a short new sequence
noreturnRemoves carriage return from ASCII files
notseqExcludes a set of sequences and writes out the remaining ones
nthseqWrites one sequence from a multiple set of sequences
pasteseqInsert one sequence into another
revseqReverse and complement a sequence
seqretReads and writes (returns) sequences
seqretsplitReads and writes (returns) sequences in individual files
splitterSplit a sequence into (overlapping) smaller sequences
swissparseRetrieves sequences from swissprot using keyword search
trimestTrim poly-A tails off EST sequences
trimseqTrim ambiguous bits off the ends of sequences
unionReads sequence fragments and builds one sequence
vectorstripStrips out DNA between a pair of vector sequences
yankReads a sequence range, appends the full USA to a list file

Author(s)

This application was written by Gary Williams (gwilliam@hgmp.mrc.ac.uk)

History

Written (6 March 2001) - Gary Williams

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments